Description
Saccharomyces boulardii is a tropical species of yeast, isolated from fruit (India). We provide off-white to creamish white colored freeze-dried culture of S. boulardii with characteristic odor, depending on the concentration. S. boulardii used for treating diarrhea, IBS, IBD, Crohn's disease, ulcerative colitis, Lyme disease, lactose intolerance, UTIs, vaginal yeast infections, high cholesterol levels, hives, fever blisters etc.
Manufacturing
Saccharomyces boulardii is manufactured through a fermentation process and freeze-dried at a DSIR (Govt. of India) Certified plant.
Morphology
This is a species of Saccharomyces, S. boulardii are unicellular, globose, and ellipsoid to elongate in shape (oval cells) with thick-walled cells which are approximately 10 µm long by 5 µm wide. S.boulardii was asporogenous and had better heat tolerance and acid tolerance growing well at 37°C and pH 2.0. We also found that thermal death temperature was 55~56°C and S.boulardii is well ethanol-tolerant, S.boulardii can tolerate 20% ethanol.
Identification
By 18s r RNA sequencing method.
FASTA Sequence:
TGTTGGAATAAGACTCAACTGCGATCTATCGACTAGTACTTATAGTACCAGTATATTATATACGGTGTGAAAAGACGACATGAAGATTGAGAAAATGGTCCCAAGATTTAATGGACACTGAAATGCAAAAGTTGATAATGTAATATGAAAATTAAGGACAGCATATTAAACAGGAGAGGAAATAATGGTATTTTCACATATAGATATGAATTTTCCCTTTTTTTTGTTCCTATATCTCTGATCATAAGTTATAATATACTTTGTGCATCTAATATCATGCCTTTTCAACAATGAAATACCAGCAGTTATCAA
BLAST result of TSB-009 (Sequences producing significant alignments with NCBI Genomic data)
Fig 1. Sequencing of the S. boulardii genome reveals changes in genes involved in cell wall organization.
(A) The S. boulardii ATCC MYA-797 genome was sequenced, yielding an 11.5 Mbp draft genome with 135 contigs of 1000 bp or more. Shown is a circle plot depicting synteny between the draft genome contigs and the S. boulardii sacCer3 reference genome. (B) Summary of sequence differences between the S. boulardii draft genome reported here and the S. boulardii reference genome. (C) Gene ontology analysis reveals that differences between S. boulardii and S. boulardii coding regions occur in genes critical for cell wall formation. Selected ontology terms and their Holm-Bonferroni p-values are shown.
(D) Examples of the amino acid substitutions in the coding regions of SBE22 [37], ALG2 [38], LDS2 [39], and SPR1 [40], which all play important roles in cell wall formation.
Fig. The cell wall of S. boulardii is thicker than in S. boulardii strains.
S. boulardii (A, D) and S. boulardii BY4741 (B,E) and W303 (C, F) were cryopreserved and imaged via transmission electron microscopy. Scale bars denote 500 nm (A-C) and 50 nm (D-F).
(G) Quantification of total cell wall thickness for each strain was calculated taking the average of 23 cells per strain. Error bars depict the standard error of the mean (SEM), * p <0.05 relative to S. boulardii, Kruskal-Wallis with Dunn’s multiple comparison test
Antibody Levels
Fig. S. boulardii induces increased total but not antigen specific fecal and serum antibody levels.
Potency
Customized
Storage
In a sealed package store in a cool, dry place, preferably at temperature not exceeding 8°C
pH- Tolerance Profiles
Saccharomyces boulardii (TSB-009) exhibited excellent probiotic properties in vitro, including artificial gastric juice, intestinal juice, and bile salt tolerance
| Table: Survival rate of Saccharomyces boulardii at artificial gastric juice, intestinal juice, and bile (%) | |||||
|---|---|---|---|---|---|
| Strain | Gastric Juice | Intestinal Juice | Gastric Juice | Intestinal Juice | Bile Salt Tolerance |
| 1h incubation | incubation 1h | incubation 2h | incubation 2h | incubation | |
| Bacillus Subtilis | 100 | 100 | 93.4±0.5 | 93.4±0.5 | 92±0.5 |
| Values were expressed as means ± SDs of three independent repetitions. | |||||
Antioxidant Properties
| Table: Antioxidant properties of S. boulardii | ||
|---|---|---|
| Activity | S. boulardii | |
| Cell-free extract | Ethyl acetate fraction | |
| TPC (mg GAE.g-1) | 8.11 ± 0.30 | 8.15 ± 0.25 |
| TFC (mg QE.g-1) | 0.15 ± 0.04 | 0.17 ± 0.05 |
| DPPH assay (%Inhibition) | 38.16 ± 0.11 | 38.16 ± 0.11 |
| TEAC (μM) | 181.89 ± 0.22 | 184.21 ± 0.31 |
Statistically significantly different (p<0.05) from S. boulardii; TPC, total phenolic content; TFC, total flavonoid content; DPPH, scavenging activity of 1,1-diphenyl-2-picrylhydrazyl, TEAC, trolox equivalent antioxidant capacity assay.
Antimicrobial Activity Against Potentially Pathogenic Bacteria
Saccharomyces boulardii (ABS-034) Showed good antimicrobial activities
Figure : Antibacterial activity of Saccharomyces boulardii against four pathogenic bacteria (Enteropathogenic Escherichia coli, Salmonella, Staphylococcus aureus and Clostridium perfringens. Bars represented the means ± SDs of three independent repetitions.
| Table: Inhibition of Candida albicans hyphae formation by the filtrate and extract from Saccharomyces boulardii culture | |||||
|---|---|---|---|---|---|
| Control | S.b. filtrate | 0.16 mg mL−1 of S.b. extract | 0.24 mg mL−1 of S.b. extract | 0.24 mg mL−1 of S.b. extract | |
| % Hyphae | 99.10 ± 0.10 | 91.50 ± 6.76 | 91.50 ± 6.76 | 80.40 ± 1.97 | 63.50 ± 9.89 |
| The assay was carried out in a rabbit serum for 2 h at 37°C. | |||||
Fig. Inhibition of Candida albicans hyphae formation, after 2 h incubation at 37°C, by the extract from the Saccharomyces boulardii
Antibiotic Resistance
Safety consideration for probiotic microbes is the presence of DNA that provides assessment of undesirable side-effects. Protection against the effects of antibiotics. Such antibiotic resistant genes are found naturally in yeast/bacteria, but the question is whether they are resistant to antibiotics that are used in the treatment of humans and also whether they are the type of genes that can be transferred to other bacteria. If such genes are transferrable to other bacteria, then they could be taken up by bacteria in the human gut flora and subsequently passed onto pathogens creating a new type of resistant pathogen. S. boulardii TSB-009 strain tested against a range of antibiotics, and strains were sensitive (not resistant) to all the antibiotics important in medical treatment, as listed in a report of the European Food Safety Authority.
- Not resistant to tetracycline
- Not resistant to aminoglycoside
- Not resistant to chloramphenicol
- Not resistant to MLS
- Not resistant to macrolide
- Not resistant to β-lactams
- Not resistant to quinupristin–dalfopristin
Toxin Production
Pathogenic genes; specifically, the organism were tested for the presence of genes responsible for the production of various toxins, and other harmful substances such as haemolysin (blood cell disruption) and lecithinase (cell membrane disruption). No such genes were found.
Figure: Yeast live cell with pathogenic microorganisms attached to its wall.
In the presence S. boulardii TSB-009 in the digestive system causes a phenomenon called competitive exclusion, in which certain bacteria capable of causing disease adhere to the surface of the yeast, and so removing a significant amount of harmful microorganisms and allowing the defend more effectively
Product Specifications
Bluk Density : ≥0.73 g/ml
Packaging : High barrier foil laminate bags.
Purity And Legal Status : Local regulations should always be consulted concerning the status of the product as legislation regarding its intended use may vary from country to country.
Microbiological Specifications
- Total Viable Cell: Count : >50 Billion CFU/G
- Yeast and Mold : <100/g
- Enterococci : <100/g
- S. aureus : Absent/g
- E. coli : Absent/Gm
- Salmonella : Absent/Gm
- Coliform : Absent/Gm
Other Specifications
| Test | Specifications |
|---|---|
| Culture Description | Creamish white, lyophilized powder |
| Moisture Content | Less than 5% |
| Morphological Characteristics | Unicellular, globose and ellipsoid to elongate in shape |
| Bulk Density | ≥ 0.7 g/ml |
| Particle Size | ≥ 90% < 250 μm |
| Heavy metals (Pb) | ≤ 1ppm |
| Heavy metals (As) | ≤ 2ppm |
| Total Heavy Metals (Ar, Cd, Pb, Cu and Hg) | ≤ 10 ppm |
| Smell (Olfactory) | Sweet, fermented Smell |